yfnI [2018-12-07 15:41:01]

polyglycerolphosphate lipoteichoic acid synthase, general stress protein, major secreted protein, required for survival at low temperature (4°C)

Locus: BSU07260

Isoelectric point: 5.95

Molecular weight: 73.14 kDa

Protein length: 639 aa

Gene length: 1917 bp

Function: biosynthesis of lipoteichoic acid

Product: minor lipoteichoic acid synthetase

Essential: no

Synonyms: yetP

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of lipoteichoic acid
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of lipoteichoic acid
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Secreted proteins
• Groups of genes → Phosphoproteins → Phosphorylation on either a Ser, Thr or Tyr residue

Gene

Coordinates: 796,314 → 798,233

Phenotypes of a mutant

• induction of SigM and SigX activities PubMed
• more sensitive to nisin PubMed
• increased conjugation of ICEBs1 PubMed
• suppression of the growth and morphology defects of a glmR mutant PubMed

The protein

Protein family

• LTA synthase family (according to Swiss-Prot)

Paralogous protein(s)

• YqgS, LtaS, YvgJ

Modification

• phosphorylation on (Thr-311 OR Ser-312) PubMed
• can be phosphorylated by PrkC in vitro PubMed

Structure

• 2W5Q (LtaS from S. aureus, corresponds to aa 215 ... 632 of YfnI) PubMed

Localization

• extracellular (signal peptide) PubMed

Expression and Regulation

Operons

• Genes: yfnI
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon

  Additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of yfnI PubMed

Biological materials

Mutant

• MGNA-C226 (yfnI::erm), available at the NBRP B. subtilis, Japan
• SM-NB (yfnI-spc), available in Anne Galinier's and Boris Görke's labs
• GP1390 yfnI::spc, available in Jörg Stülke's lab
• GP1397 yfnI::ermC, available in Jörg Stülke's lab
• BKE07260 (ΔyfnI::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG
• BKK07260 (ΔyfnI::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGCAACCTCTACTTTCT, downstream forward: _UP4_TAAGATGAAAAAGAGCCTTG

References

Reviews

Loading

Original publications

Loading